Re: Second law of Thermodynamics
Moorad Alexanian (alexanian@UNCWIL.EDU)
Wed, 19 Nov 1997 09:43:59 -0500 (EST)
At 08:05 PM 11/18/97 -0600, Glenn Morton wrote:
>Hi Moorad,
>
>Of the second law, At 03:42 PM 11/18/97, Moorad Alexanian wrote:
>
>>The law deals with isolated systems only. If applied to the universe, the
>>law would indicate that the universe began in a highly improbable
>>configuration and is evolving into a more probable configuration. This is
>>also related to the direction of time. Of course, this is what physicists
>>believe. No one has a theory for it.
>
>Let me point out that evolution is exactly in harmony with the 2nd law.
>Consider the following genomes of ten animals.
>
>1:
>AGGTCCGTGGTAATCTCGATCCTAAGCTTGAACGA
>2:
>AGGTCCGTGGTAATCTCGATCCTAAGCTTGAACGA
>3:
>AGGTCCGTGGTAATCTCGATCCTAAGCTTGAACGA
>4:
>AGGTCCGTGGTAATCTCGATCCTAAGCTTGAACGA
>5:
>AGGTCCGTGGTAATCTCGATCCTAAGCTTGAACGA
>6:
>AGGTCCGTGGTAATCTCGATCCTAAGCTTGAACGA
>7:
>AGGTCCGTGGTAATCTCGATCCTAAGCTTGAACGA
>8:
>AGGTCCGTGGTAATCTCGATCCTAAGCTTGAACGA
>9:
>AGGTCCGTGGTAATCTCGATCCTAAGCTTGAACGA
>10:
>AGGTCCGTGGTAATCTCGATCCTAAGCTTGAACGA
>
>Notice that they are ALL the same. This is a highly IMPROBABLE
>circumstance. It is like having all the molecules of air in your room
>congregate under your table. It is possible but highly improbable. But
>during reproduction copying mistakes (mutations) are made in the genomes of
>each animal's offspring. Mutation takes each of these animals and moves
>them to the more PROBABLE STATE where their genomes are different and where
>their DNA creates different animals. Evolution not only obeys the second law
>of thermo; it is DRIVEN by it!!!
>
>Those who say that one genome cannot mutate into another genome are the ones
>who are violating the 2nd law.
>
>glenn
We understand the second law of thermodynamics in a probabilistic sense.
Therefore, if a set of outcomes are equally likely, then the most probable
configuration is the one that randomness will drive the system to. Is that
the case with your example? Or are there constraints that would exclude some
of the possible outcomes? What laws determine such constraints? A simple
minded model of the decrease in entropy due to human civilization shows that
the lighting of a match gives rise to a larger increase of entropy than the
decrease in entropy due to all past actions of civilized societies.
Therefore, I have no qualms with what you say. I have never used to second
law against evolutionary theory.
Moorad